Basic Concepts in Chemistry and Biochemistry
Prof. Casteel, Sept 17, 2001

The nature of matter - stuff
all stuff (matter) is chemical
composed of atoms, the building materials of matter
Atoms come in ~109 types (so far)
each type is called an element
all atoms of a particular element are identical to each other
but different from all other elements
The thing that makes one atom/element different from another
depends on the number of sub-atomic (smaller than atomic) parts in each
Atoms have a central core - nucleus
composed of protons (positively charged) and neutrons (no charge)
the number of protons present defines the atom
6 protons for carbon, 50 for tin, 79 for gold, 92 for uranium, etc.
The periodic table is a list of atoms arranged in order of increasing # of protons

Atoms can be combined, joined together
this process is called bonding
leads to groupings of atoms: compounds, molecules, etc.
Two types of bonding are important
Ionic: when atoms or groups of atoms are charged, + or -
opposite charges attract each other (electrostatic attraction)
this is a very strong force holding ions to each other
example: table salt (sodium chloride, NaCl, Na+ Cl-)
Covalent: when atoms share electrons (do not worry about the details)
also a very strong force holding atoms together
example: water H-O-H, the bond between the H and the O is covalent

Look at tables of atomic composition of geosphere and biosphere
the atoms that are important in the earth are not the mains one in life
For living systems, important atoms are carbon (C), hydrogen (H), oxygen (O), nitrogen (N), and phosphorus (P)
The chemistry of carbon molecules is called organic chemistry
carbon is a central "scaffold" atom for biomolecules
forms four strong covalent bonds, very versatile
allows for a wide range of atom combinations
For the purposes of life, it is the arrangement of the atoms that is important
a simple formula, say C6H12O6, doesn't tell very much
this might be inositol or glucose or maltose or some other thing
the structure, connectivity of the atoms is the important part

A final preliminary concept: polarity
some molecules are more polar than others
a function of the types of atoms present and how they are arranged
think about salad dressing: get a two layers, oil and water (vinegar)
oil is a non-polar substance
greasy, lipophilic (fat-loving) hydrophobic (water-fearing)
water is a polar substance, hydrophilic (water-loving)
Polar and non-polar is important in many biological systems
involved in how proteins fold
involved in how cell membranes function, etc.

Turn our attention to several classes of important biomolecules
proteins, lipids, and nucleic acids

Proteins
start with small pieces called amino acids
contain both amine groups (NH2) and acid groups (COOH)
see handouts
one version has it all drawn out with all the atoms
20 different structures
other version has simplified drawings
groups them by polarity: hydrophobic, hydrophilic, charged, etc.
Stereoisomerism
each amino acid has a special property
not superimposable on its mirror image
just like the right hand is to the left hand
vast majority of naturally occurring amino acids are left handed
Can link amino acids together to form chains
the amine -NH2 group combines with the acid group HO2C-
to give -NHOC- (with loss of water HOH)
The number of amino acids in a chain can vary greatly
from just a few, these would be molecules called peptides
to hundreds, these are the polypeptides or proteins
Proteins are very large molecules containing thousands of atoms
Each protein is characterized by a particular order of amino acids
amino acids do not appear at random in a protein chain
the sequence or order of the amino acids defines what protein it is

Protein structure
protein chains adopt defined structures
not random like a bowl of spaghetti cooking in boiling water
but folded on itself in a very precise way
the folding is unique and specific to a particular protein
There are several layers of structure in proteins
primary (1°) structure is the sequence of the amino acids
secondary (2°) structure is the presence of regions of organized patterns
tertiary (3°) structure is the folding of the complete chain into a well-defined shape
quaternary (4°) structure is the association of several protein chains or the association of protein chains with some non-protein pieces
Primary structure has already been mentioned
Secondary structure
two general patterns of protein organization have been identified
the alpha (a) helix, where the chain of the protein spirals around itself
the beta (b) sheet, where the chain folds back on itself in parallel strands
see handout for pictures
these structures are held together by interactions between the atoms of the chain
ionic bonding can happen between (-) and (+) groups on the chain
a weaker association (called hydrogen bonding) happens between the amino acid groups and between the protein chain
although an individual hydrogen bond is quite weak, the presence of perhaps hundreds in one folded protein help define the overall structure
the a helix and b sheet are patterns that are seen over and over in almost all proteins
some proteins will be composed of many sections of a helix
some proteins will be composed of many sections of b sheet
other proteins will have both patterns in different areas
Tertiary structure
by combining the regions of a helix and b sheet with the other regions which link helix and sheet (called random coil), get a total folded structure for the protein
Quaternary structure
some proteins are actually made up of several different protein chains
hemoglobin (oxygen carrying protein of the blood) is made up of 4 chains

Nucleic Acids
like the proteins, these are made up of long strings of smaller units
the units are nucleotides (in proteins, the units were amino acids)
Two kinds of nucleic acids
DNA: deoxyribonucleic acid, the genetic material, in nucleus of cells
contains all the information about that particular organism
RNA: ribonucleic acid, used in converting the information of DNA
into proteins
The units making up DNA and RNA are nucleotides
nucleotides themselves are composed of 3 parts
the "sugar", the phosphate, and the "base" or heterocycle
[besides referring to that stuff in the sugar bowl, "the sugars" are also a class of chemical compounds]
look at handout for structures
Chemically, DNA and RNA are similar
both are long strings of nucleotides
phosphate same in both, the group that links one nucleotide to the next
in RNA the sugar is ribose
in DNA the sugar is deoxyribose (missing one -OH group)
the 3 of the 4 bases are common to both DNA and RNA
they are A (adenine), G (guanine), and C (cytosine)
the fourth base differs; in RNA it is U (uracil), in DNA T (thymine)
The nucleic acids are then long strings of the nucleotides
using a 4 letter alphabet
ACGTGGCACTAGCGGATCATCGAGGATCTTTAGAGACTCTA etc.
DNA has further structure (just like proteins did)
the DNA double helix
two strands of DNA entwine to form a helix
but this again is not a random process
the 2 strands are "complementary" meaning they line up in a specific way
A across from T, G across from C (in RNA A matches with U)
a double strand might look like this:
ACGTGGCACTAGCGGATCATCGAGGATCTTTAGAGACTCTA
TGCACCGTGATCGCCTAGTAGC TCCTAGAAATCTCTGAGAT
the order of one strand is "mirrored" by the order of the other strand

Lipids
these are the fats, oils, the greasy biomolecules
these materials are not soluble in water
characterized by non-polar (hydrophobic, lipophilic) groups
commonly long straight chains of carbon atoms with lots of hydrogens
An important group for this class are the phospholipids
phospholipids are molecules that contain both greasy (lipid) portions
and a polar (hydrophilic, water loving) phosphate group
phospholipids are important component of cells membranes
[refer to Prof. Pizzorno's lecture on membrance structure]

An aside:
although not in this lecture, this may help in understanding further issues
The Central Dogma of Molecular Biology
Replication, translation, transcription
DNA holds the info, info resides in the sequence of the nucleotides
when cells divide to form daughter cells, the info in the DNA is copied
an exact copy of the DNA (instruction manual) is given to the new cell
this is called "replication"
When time to produce new protein,
the cell makes an RNA copy of the correct region of DNA (the gene for that protein), matching up the nucleotides A to T, U to A, G to C, C to G
this RNA piece in known as the "messenger RNA"(mRNA) because it now contains the instructions for how to make the protein
this is the process of "translation"
Cellular machinery then "reads" the order of the nucleotides from the mRNA
each set of 3 nucelotides tells the cell which amino acid to link next as the new protein is being formed
from the nucleotide instructions come the precise directions for the new protein
this is called "transciption"

In the discussion of diversity in antibodies and T-cell receptors
talked about the C, V, D, J, regions of the gene
this is the DNA
the info in the DNA is then used to make the necessary proteins as described above
the antibodies and the T-cell receptors